ROUGE

Gene/Protein Characteristic Table for mKIAA1596

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173211
Description :
Clone Name :	meh01137 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 6384 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 198 bp

Genome contig ID gi65532617f_61753319
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AAACAAACTTTTATTGAATAAATCAAGGCTATTTG
Flanking genome sequence
(155219 - 155268)
----+----*----+----*----+----*----+----*----+----*
AAGGGTTTGGTCAGAGTGATTTAAGCATCTAAGTAAGGCAAAGGGCTGGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1596 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1596	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2038..6186
Length: 1382 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8BGE5	0	100.0	Fanconi anemia ...	Mus musculus
AAI50786	0	99.9	Fanconi anemia,...	Mus musculus
EDL36647	0	99.9	mCG118968 [Mus ...	Mus musculus
BAC34178	0	100.0	unnamed protein...	Mus musculus
EDL36646	4.5e-187	100.0	mCG145564 [Mus ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006166 1141 1224 PF02732 ERCC4

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006166	1141	1224	PF02732	ERCC4

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	198 bp
Genome contig ID	gi65532617f_61753319
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AAACAAACTTTTATTGAATAAATCAAGGCTATTTG
Flanking genome sequence (155219 - 155268)	----+--------+--------+--------+--------+----* AAGGGTTTGGTCAGAGTGATTTAAGCATCTAAGTAAGGCAAAGGGCTGGA

Gene/Protein Characteristic Table for mKIAA1596

Features of the cloned DNA sequence

Features of the protein sequence