Gene/Protein Characteristic Table for mKIAA1582

Length: 5802 bp

Restriction map

Length of 3'UTR	1713 bp
Genome contig ID	gi65527427f_117443246
PolyA signal sequence (None)	+----*----+----*----+----*----+---- TTTAAACCCAACTCCTAGCACTGAAGATGTTATTT
Flanking genome sequence (140414 - 140463)	----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAAAAAAAAAGAGAGAGAAAAAAAAAGAAAGAAAAGAAA

KIAA	Alignment based on:
KIAA1582	DNA sequence, AA sequence, Physical map

Coding region: 1..4089

Length: 1362 aa

Entry Exp ID% Protein Source Q3UHC0 0 100.0 Trinucleotide r... Mus musculus CAM27640 0 100.0 trinucleotide r... Mus musculus BAE27937 0 100.0 unnamed protein... Mus musculus CAX15807 0 99.4 trinucleotide r... Mus musculus EAW89483 0 90.9 trinucleotide r... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122440 1.7e-15 43.6 mKIAA1093 AK129366 1.4e-10 41.5 mKIAA1460

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000449	606	645	PF00627	Ubiquitin-associated
	IPR000504	1188	1253	PF00076	RNA-binding region RNP-1 (RNA recognition motif)
HMMSmart	IPR000449	607	644	SM00165	Ubiquitin-associated
ProfileScan	IPR000449	600	645	PS50030	Ubiquitin-associated
	NULL	761	886	PS50322	NULL
	IPR000694	887	920	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-