ROUGE

Gene/Protein Characteristic Table for mKIAA1572

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173205
Description :	Zinc finger protein 482.
Clone Name :	mfj40003 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4889 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3496 bp

Genome contig ID gi66880554r_37264333
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
TAATGGGGAAGTTTCCTTAATAAAAGTTAACCATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACCTGTGGTGTCATTGACTTCTTATTCTACTCTCTTCCCTCCTTATTTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1572 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1572	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1393
Length: 463 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC31992	3.3e-177	100.0	unnamed protein...	Mus musculus
EDM00527	5.8e-177	99.8	zinc finger and...	Rattus norvegicus
AAH60655	6.3e-176	100.0	Zinc finger and...	Mus musculus
EDM00528	1.1e-175	99.8	zinc finger and...	Rattus norvegicus
XP_548463	5.1e-171	93.9	similar to zinc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122277	2.3e-10	25.8	mKIAA0414
BC050933	2.8e-10	25.7	mKIAA0441
AK220194	3.8e-10	40.7	mKIAA4218
AK129266	5.8e-10	25.6	mKIAA1020
AK220556	1.1e-09	30.5	mKIAA4229

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 321 343 PD000003 Zinc finger

FPrintScan IPR007086 348 361 PR00048 Zinc finger

IPR007086 364 373 PR00048 Zinc finger

HMMPfam IPR000210 46 150 PF00651 BTB/POZ

IPR007087 296 318 PF00096 Zinc finger

IPR007087 321 343 PF00096 Zinc finger

IPR007087 349 371 PF00096 Zinc finger

IPR007087 377 400 PF00096 Zinc finger

HMMSmart IPR000210 56 150 SM00225 BTB/POZ

IPR007087 296 318 SM00355 Zinc finger

IPR007087 321 343 SM00355 Zinc finger

IPR007087 349 371 SM00355 Zinc finger

IPR007087 377 400 SM00355 Zinc finger

ProfileScan IPR000210 56 120 PS50097 BTB/POZ

IPR007087 296 318 PS50157 Zinc finger

IPR007087 321 348 PS50157 Zinc finger

IPR007087 349 376 PS50157 Zinc finger

IPR007087 377 400 PS50157 Zinc finger

ScanRegExp IPR007087 298 318 PS00028 Zinc finger

IPR007087 323 343 PS00028 Zinc finger

IPR007087 351 371 PS00028 Zinc finger

IPR007087 379 400 PS00028 Zinc finger

IPR001220 416 422 PS00307 Legume lectin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	321	343	PD000003	Zinc finger
FPrintScan	IPR007086	348	361	PR00048	Zinc finger
IPR007086	364	373	PR00048	Zinc finger
HMMPfam	IPR000210	46	150	PF00651	BTB/POZ
IPR007087	296	318	PF00096	Zinc finger
IPR007087	321	343	PF00096	Zinc finger
IPR007087	349	371	PF00096	Zinc finger
IPR007087	377	400	PF00096	Zinc finger
HMMSmart	IPR000210	56	150	SM00225	BTB/POZ
IPR007087	296	318	SM00355	Zinc finger
IPR007087	321	343	SM00355	Zinc finger
IPR007087	349	371	SM00355	Zinc finger
IPR007087	377	400	SM00355	Zinc finger
ProfileScan	IPR000210	56	120	PS50097	BTB/POZ
IPR007087	296	318	PS50157	Zinc finger
IPR007087	321	348	PS50157	Zinc finger
IPR007087	349	376	PS50157	Zinc finger
IPR007087	377	400	PS50157	Zinc finger
ScanRegExp	IPR007087	298	318	PS00028	Zinc finger
IPR007087	323	343	PS00028	Zinc finger
IPR007087	351	371	PS00028	Zinc finger
IPR007087	379	400	PS00028	Zinc finger
IPR001220	416	422	PS00307	Legume lectin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3496 bp
Genome contig ID	gi66880554r_37264333
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TAATGGGGAAGTTTCCTTAATAAAAGTTAACCATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCTGTGGTGTCATTGACTTCTTATTCTACTCTCTTCCCTCCTTATTTC

Gene/Protein Characteristic Table for mKIAA1572

Features of the cloned DNA sequence

Features of the protein sequence