ROUGE

Gene/Protein Characteristic Table for mKIAA1569

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122526
Description :
Clone Name :	mbh04236 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4548 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1232 bp

Genome contig ID gi65551972f_67971797
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TGGTGTATTTACAAATAAAGCTGATATTTAAATTG
Flanking genome sequence
(144160 - 144209)
----+----*----+----*----+----*----+----*----+----*
AACTTGTCCTTTTTGTATTTTATAATGTGATGCCACATTATAAAAATGAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1569 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1569	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..3307, 3316..4257
Length: 1415 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL09621	97.0	mCG127903, isof...	Mus musculus
EDM14743	84.2	rCG46902 [Rattu...	Rattus norvegicus
XP_537341	66.4	hypothetical pr...	Canis lupus fam...
AAI44482	67.9	CEP192 protein ...	Homo sapiens
AAI44481	67.9	CEP192 protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR001865 221 232 PS00962 Ribosomal protein S2

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR001865	221	232	PS00962	Ribosomal protein S2

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1232 bp
Genome contig ID	gi65551972f_67971797
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TGGTGTATTTACAAATAAAGCTGATATTTAAATTG
Flanking genome sequence (144160 - 144209)	----+--------+--------+--------+--------+----* AACTTGTCCTTTTTGTATTTTATAATGTGATGCCACATTATAAAAATGAG

Gene/Protein Characteristic Table for mKIAA1569

Features of the cloned DNA sequence

Features of the protein sequence