ROUGE |
Gene/Protein Characteristic Table for mKIAA1567 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129395 |
---|---|
Eukaryotic translation initiation factor 2C 4. | |
mid08086 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Note : | We replaced mph01538, former representative clones for mKIAA1567 with mid08086. (2004/6/22) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3080 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1057 bp Genome contig ID gi65493515r_125419329 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CAAAACTTATTTTATAGTCAGTGTCCTGTCACTTTFlanking genome sequence
(99951 - 99902) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGAAGCTGGAACCAGGATGCTTTGTGATCGGTCAGGC
KIAA Alignment based on: KIAA1567 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..765, 782..2023
Length: 668 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003100 | 82 | 218 | PF02170 | Argonaute and Dicer protein |
IPR003165 | 316 | 627 | PF02171 | Stem cell self-renewal protein Piwi | |
ProfileScan | IPR003100 | 82 | 195 | PS50821 | Argonaute and Dicer protein |
IPR003165 | 316 | 627 | PS50822 | Stem cell self-renewal protein Piwi |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |