ROUGE

Gene/Protein Characteristic Table for mKIAA1567

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129395
Description :	Eukaryotic translation initiation factor 2C 4.
Clone Name :	mid08086 [Vector Info]
Source :	Mouse adult pancreatic islet
Note :	We replaced mph01538, former representative clones for mKIAA1567 with mid08086. (2004/6/22)

Features of the cloned DNA sequence	Description

Length: 3080 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1057 bp

Genome contig ID gi65493515r_125419329
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CAAAACTTATTTTATAGTCAGTGTCCTGTCACTTT
Flanking genome sequence
(99951 - 99902)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGAAGCTGGAACCAGGATGCTTTGTGATCGGTCAGGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1567 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1567	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..765, 782..2023
Length: 668 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL30284	1.3e-175	90.2	eukaryotic tran...	Mus musculus
AAH96023	1.7e-175	91.8	Eukaryotic tran...	Mus musculus
BAC26738	1.9e-175	91.8	unnamed protein...	Mus musculus
Q8CJF8	8.6e-174	91.2	Eukaryotic tran...	Mus musculus
Q9HCK5	2.6e-173	90.7	Eukaryotic tran...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220193	1e-82	75.0	mKIAA4215

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003100 82 218 PF02170 Argonaute and Dicer protein

IPR003165 316 627 PF02171 Stem cell self-renewal protein Piwi

ProfileScan IPR003100 82 195 PS50821 Argonaute and Dicer protein

IPR003165 316 627 PS50822 Stem cell self-renewal protein Piwi

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003100	82	218	PF02170	Argonaute and Dicer protein
IPR003165	316	627	PF02171	Stem cell self-renewal protein Piwi
ProfileScan	IPR003100	82	195	PS50821	Argonaute and Dicer protein
IPR003165	316	627	PS50822	Stem cell self-renewal protein Piwi

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1057 bp
Genome contig ID	gi65493515r_125419329
PolyA signal sequence (None)	+--------+--------+----*----+---- CAAAACTTATTTTATAGTCAGTGTCCTGTCACTTT
Flanking genome sequence (99951 - 99902)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGAAGCTGGAACCAGGATGCTTTGTGATCGGTCAGGC

Gene/Protein Characteristic Table for mKIAA1567

Features of the cloned DNA sequence

Features of the protein sequence