| ROUGE |
Gene/Protein Characteristic Table for mKIAA1540 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK081276 |
|---|---|
| Probable G protein-coupled receptor GPR83 precursor. | |
| mbp01012 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 1319 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 45 bp Genome contig ID gi65519420f_14593973 PolyA signal sequence
(None)
AAGTTGGTGGGGGAGGGTTCTTTCCTCTCACAATTFlanking genome sequence
(108314 - 108363)
GACCAGACACTAACAGAGTTGGAAAGTAACACAGAAGCAGTGAGATGCTT
KIAA Alignment based on: KIAA1540 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..1274
Length: 423 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
