ROUGE |
Gene/Protein Characteristic Table for mKIAA1528 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173192 |
---|---|
Deltex protein 2. | |
mth01821 [Vector Info] | |
Source : | Mouse adult thymus |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5420 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 377 bp Genome contig ID gi65498774f_134933051 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
CCTCAGATTTTATTTGCAATAAAGATCCTATAGCCFlanking genome sequence
(113308 - 113357) ----+----*----+----*----+----*----+----*----+----*
AACCTGCATCTGTTGGGAAGTTTTGTGTGTCCGTCTGTCTGTCTGATGAC
KIAA Alignment based on: KIAA1528 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 4213..5043
Length: 276 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001841 | 66 | 126 | PF00097 | Zinc finger |
HMMSmart | IPR001841 | 66 | 126 | SM00184 | Zinc finger |
ProfileScan | IPR001841 | 66 | 127 | PS50089 | Zinc finger |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |