ROUGE

Gene/Protein Characteristic Table for mKIAA1509

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173188
Description :	DVL-binding protein DAPLE.
Clone Name :	mbg12984 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5284 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3176 bp

Genome contig ID gi65532617r_96256981
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
GGACAGGGCTGTAATAAAGTGGAAAGGAATGTGAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGAGCCCTGGTTTTCTTCAGTAAATGCTGGCTGCATGCAAGAGGGCCCCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1509 DNA sequence

KIAA	Alignment based on:
KIAA1509	DNA sequence

Features of the protein sequence	Description

Coding region: 3..2078, 2536..3996
Length: 1178 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6VGS5	96.7	Protein Daple; ...	Mus musculus
EDL18883	96.6	RIKEN cDNA 0610...	Mus musculus
EDL18884	96.6	RIKEN cDNA 0610...	Mus musculus
XP_343097	88.0	similar to DVL-...	Rattus norvegicus
XP_001928768	73.7	similar to Prot...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129310	6.3e-36	41.0	mKIAA1212

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 236 325 PS50322 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	236	325	PS50322	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3176 bp
Genome contig ID	gi65532617r_96256981
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GGACAGGGCTGTAATAAAGTGGAAAGGAATGTGAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGAGCCCTGGTTTTCTTCAGTAAATGCTGGCTGCATGCAAGAGGGCCCCT

Gene/Protein Characteristic Table for mKIAA1509

Features of the cloned DNA sequence

Features of the protein sequence