ROUGE

Gene/Protein Characteristic Table for mKIAA1452

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC037637
Description :	DNA-directed RNA polymerases III 80 kDa polypeptide.
Clone Name :	mej00722 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 2569 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 306 bp

Genome contig ID gi65511124f_114693383
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TAAAGAGAGTGTACACTGACATGGGCAGGATTACG
Flanking genome sequence
(128025 - 128074)
----+----*----+----*----+----*----+----*----+----*
AAAATCATGGTTTAATATTTTCCTCTTTTAAATGAATGCCAACATAGTTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1452 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1452	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 116..2263
Length: 715 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9CZT4	100.0	DNA-directed RN...	Mus musculus
BAE35318	99.9	unnamed protein...	Mus musculus
BAE27037	99.9	unnamed protein...	Mus musculus
BAB28084	99.7	unnamed protein...	Mus musculus
EDM17598	98.0	polymerase (RNA...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006886 9 439 PF04801 Sin-like protein conserved region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006886	9	439	PF04801	Sin-like protein conserved region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	306 bp
Genome contig ID	gi65511124f_114693383
PolyA signal sequence (None)	+--------+--------+----*----+---- TAAAGAGAGTGTACACTGACATGGGCAGGATTACG
Flanking genome sequence (128025 - 128074)	----+--------+--------+--------+--------+----* AAAATCATGGTTTAATATTTTCCTCTTTTAAATGAATGCCAACATAGTTA

Gene/Protein Characteristic Table for mKIAA1452

Features of the cloned DNA sequence

Features of the protein sequence