ROUGE

Gene/Protein Characteristic Table for mKIAA1434

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122510
Description :
Clone Name :	mbh00436 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4353 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1468 bp

Genome contig ID gi66880554r_131943074
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
CTGCCTCCTAAGTGGTATTAAAGTCATGCGCCACC
Flanking genome sequence
(99864 - 99815)
----+----*----+----*----+----*----+----*----+----*
ACCTTTGGCTTCCTGATTTGTTCTTAACAGTGCAACAATGGGGGTTTGGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1434 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1434	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2067..2885
Length: 272 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE38686	1e-116	98.9	unnamed protein...	Mus musculus
BAC34739	1e-116	98.9	unnamed protein...	Mus musculus
AAH33408	1.2e-116	98.9	Preimplantation...	Mus musculus
EDL28354	1.4e-116	98.9	preimplantation...	Mus musculus
Q8C0L9	1.6e-116	98.9	Putative glycer...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004129 2 213 PF03009 Glycerophosphoryl diester phosphodiesterase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004129	2	213	PF03009	Glycerophosphoryl diester phosphodiesterase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1468 bp
Genome contig ID	gi66880554r_131943074
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- CTGCCTCCTAAGTGGTATTAAAGTCATGCGCCACC
Flanking genome sequence (99864 - 99815)	----+--------+--------+--------+--------+----* ACCTTTGGCTTCCTGATTTGTTCTTAACAGTGCAACAATGGGGGTTTGGG

Gene/Protein Characteristic Table for mKIAA1434

Features of the cloned DNA sequence

Features of the protein sequence