ROUGE |
Gene/Protein Characteristic Table for mKIAA1434 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122510 |
---|---|
mbh00436 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4353 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1468 bp Genome contig ID gi66880554r_131943074 PolyA signal sequence
(ATTAAA,-19) +----*----+----*----+----*----+----
CTGCCTCCTAAGTGGTATTAAAGTCATGCGCCACCFlanking genome sequence
(99864 - 99815) ----+----*----+----*----+----*----+----*----+----*
ACCTTTGGCTTCCTGATTTGTTCTTAACAGTGCAACAATGGGGGTTTGGG
KIAA Alignment based on: KIAA1434 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2067..2885
Length: 272 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004129 | 2 | 213 | PF03009 | Glycerophosphoryl diester phosphodiesterase |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |