KIAA1434

Product ID	ORK00229
Accession No	AB037855
Description	glycerophosphocholine phosphodiesterase 1
Clone name	hh05877
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5443 bp) Predicted protein sequence (677 aa)
HaloTag ORF Clone	FHC00229
Flexi ORF Clone	FXC00229
Source	Human adult brain
Rouge ID	mKIAA1434 by Kazusa Mouse cDNA Project

Length: 5443 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3220 bp
Genome contig ID	gi51511747r_5373087
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AGTTATGAACTAGATAAATAAATGGTGGTGGCAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATCCTAGTTTCCTAACTCAGATTGTTTCACGATAAACACAGTTTTGTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	5473087	5539664	20	99.3	Perfect prediction

Length: 677 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_514503	99.9	similar to RP5-...	Pan troglodytes
XP_001915521	97.5	similar to Puta...	Equus caballus
Q8C0L9	92.4	Putative glycer...	Mus musculus
Q80VJ4	91.0	Putative glycer...	Rattus norvegicus
XP_001166195	99.2	similar to RP5-...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002044	13	75	PD001568	Glycoside hydrolase
HMMPfam	IPR002044	29	75	PF00686	Glycoside hydrolase
HMMPfam	IPR004129	328	618	PF03009	Glycerophosphoryl diester phosphodiesterase
ProfileScan	IPR002044	1	120	PS51166	Glycoside hydrolase

Primer_f	CCTCCCTAAAGCTCATCTCAG
Primer_r	CACAAAACCCACATCCTAGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-