ROUGE

Gene/Protein Characteristic Table for mKIAA1428

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173169
Description :	DIP13 alpha.
Clone Name :	mic03043 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 5406 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4734 bp

Genome contig ID gi65540054r_24957200
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GATTTTTTAAATGTATAATAAAGTCCATGATTTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATACAGTATTTTTGTATGAAATATTTAGTTACTTTGATTTTTTTTTCCTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1428 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1428	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..672
Length: 223 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH19708	1.3e-79	100.0	Appl1 protein [...	Mus musculus
EDL24721	1.6e-79	100.0	RIKEN cDNA 2900...	Mus musculus
Q8K3H0	1.6e-79	100.0	DCC-interacting...	Mus musculus
EDL24722	1.7e-79	100.0	RIKEN cDNA 2900...	Mus musculus
EDL75067	1.2e-77	98.2	rCG39172 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006020 17 148 PF00640 Phosphotyrosine interaction region

HMMSmart IPR006020 12 151 SM00462 Phosphotyrosine interaction region

ProfileScan IPR006020 17 153 PS01179 Phosphotyrosine interaction region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006020	17	148	PF00640	Phosphotyrosine interaction region
HMMSmart	IPR006020	12	151	SM00462	Phosphotyrosine interaction region
ProfileScan	IPR006020	17	153	PS01179	Phosphotyrosine interaction region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4734 bp
Genome contig ID	gi65540054r_24957200
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GATTTTTTAAATGTATAATAAAGTCCATGATTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATACAGTATTTTTGTATGAAATATTTAGTTACTTTGATTTTTTTTTCCTC

Gene/Protein Characteristic Table for mKIAA1428

Features of the cloned DNA sequence

Features of the protein sequence