ROUGE |
Gene/Protein Characteristic Table for mKIAA1427 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129357 |
---|---|
synaptotagmin 13. | |
mbg18863 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6118 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2057 bp Genome contig ID gi66880554f_92519818 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
TCTTACAGTGGTAAATAAATCGTTTTCCAATCGGGFlanking genome sequence
(140593 - 140642) ----+----*----+----*----+----*----+----*----+----*
TTGGCAGCCCAGTGTTTCTCTTTGTTCCTTTACATTAATATTTTAGATGT
KIAA Alignment based on: KIAA1427 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..596, 3324..4061
Length: 443 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000008 | 192 | 276 | PF00168 | C2 |
IPR000008 | 321 | 411 | PF00168 | C2 | |
HMMSmart | IPR000008 | 320 | 436 | SM00239 | C2 |
ProfileScan | IPR000008 | 318 | 411 | PS50004 | C2 |
IPR002149 | 408 | 443 | PS50098 | A-latrotoxin receptor interaction |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |