ROUGE

Gene/Protein Characteristic Table for mKIAA1425

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AF438610
Description :	DNA methyltransferase 1-associated protein 1.
Clone Name :	mbk00922 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 1513 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 54 bp

Genome contig ID gi65493515r_116533587
PolyA signal sequence
(AATAGA,-25)
+----*----+----*----+----*----+----
GTATGGTGTAAATAGAGCTGTTACATTGGACTGGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTGATTGTTTCCTCACTTCCTCATTAACCTTGGCTGGAATGACAGTCTGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1425 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1425	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1459
Length: 485 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9JI44	1.4e-173	100.0	DNA methyltrans...	Mus musculus
XP_513103	8.5e-173	96.5	DNA methyltrans...	Pan troglodytes
XP_532609	1.2e-172	96.9	similar to DNMT...	Canis lupus fam...
AAH92651	3.3e-172	98.9	DNA methyltrans...	Rattus norvegicus
AAI16129	1.2e-169	97.4	DNA methyltrans...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008468 260 424 PF05499 DNA methyltransferase 1-associated 1

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008468	260	424	PF05499	DNA methyltransferase 1-associated 1

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	54 bp
Genome contig ID	gi65493515r_116533587
PolyA signal sequence (AATAGA,-25)	+--------+--------+----*----+---- GTATGGTGTAAATAGAGCTGTTACATTGGACTGGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTGATTGTTTCCTCACTTCCTCATTAACCTTGGCTGGAATGACAGTCTGA

Gene/Protein Characteristic Table for mKIAA1425

Features of the cloned DNA sequence

Features of the protein sequence