ROUGE

Gene/Protein Characteristic Table for mKIAA1404

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC037702
Description :
Clone Name :	mbj01136 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 2347 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 926 bp

Genome contig ID gi66880554r_166392533
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
TAACCTATAAAGCCAATTAATAAAAACAATGATTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAGCCTGTCATCTCTTATCTGTGCTTGCTTTGTTGCTGTATTGATA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1404 DNA sequence

KIAA	Alignment based on:
KIAA1404	DNA sequence

Features of the protein sequence	Description

Coding region: 3..1421
Length: 472 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH25488	1.1e-182	100.0	Znfx1 protein [...	Mus musculus
CAM17308	1.5e-182	100.0	zinc finger, NF...	Mus musculus
CAM17309	2.3e-182	100.0	zinc finger, NF...	Mus musculus
BAE34040	2.9e-182	99.8	unnamed protein...	Mus musculus
Q8R151	4.4e-182	99.8	NFX1-type zinc ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 4 120 PS50311 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	4	120	PS50311	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	926 bp
Genome contig ID	gi66880554r_166392533
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TAACCTATAAAGCCAATTAATAAAAACAATGATTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAGCCTGTCATCTCTTATCTGTGCTTGCTTTGTTGCTGTATTGATA

Gene/Protein Characteristic Table for mKIAA1404

Features of the cloned DNA sequence

Features of the protein sequence