ROUGE

Gene/Protein Characteristic Table for mKIAA1385

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220267
Description :	gephyrin.
Clone Name :	mie07030 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 1283 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 856 bp

Genome contig ID gi65532617f_75426423
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
TTAATGAATAAAAAAAAAATCCTTGATCATTATTT
Flanking genome sequence
(114946 - 114995)
----+----*----+----*----+----*----+----*----+----*
AAAAATGTATTGTGCGGCCTTGTTATTTAGAAAGAGAAGAATGTTGCTCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1385 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1385	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..427
Length: 141 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001925530	9.3e-61	99.3	similar to geph...	Sus scrofa
2FTS	1.7e-60	99.3	Crystal structu...	Rattus norvegicus
1T3E	1.7e-60	99.3	Structural basi...	Rattus norvegicus
XP_001135542	2.4e-60	99.3	gephyrin isofor...	Pan troglodytes
XP_510012	2.4e-60	99.3	similar to Geph...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001453 1 53 PD002460 Molybdopterin binding domain

HMMPfam IPR005111 63 139 PF03454 MoeA

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001453	1	53	PD002460	Molybdopterin binding domain
HMMPfam	IPR005111	63	139	PF03454	MoeA

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	856 bp
Genome contig ID	gi65532617f_75426423
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TTAATGAATAAAAAAAAAATCCTTGATCATTATTT
Flanking genome sequence (114946 - 114995)	----+--------+--------+--------+--------+----* AAAAATGTATTGTGCGGCCTTGTTATTTAGAAAGAGAAGAATGTTGCTCC

Gene/Protein Characteristic Table for mKIAA1385

Features of the cloned DNA sequence

Features of the protein sequence