ROUGE

Gene/Protein Characteristic Table for mKIAA1355

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AF317839
Description :	immunoglobulin superfamily, member 9. NCAM-like protein NRT1. neural cell adhesion molecule (Ncam)-like.
Clone Name :	mpm05201 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4087 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 326 bp

Genome contig ID gi65488608f_172313199
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AAAAACAGGTGAATAATAAATGTCTGGAAACCGTT
Flanking genome sequence
(114600 - 114649)
----+----*----+----*----+----*----+----*----+----*
TCTCTGTCACCTCTCTTTGTGTTTAAGAGAGATGAGGAAGTCCCTGGATA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1355 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1355	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 192..3761
Length: 1189 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL39011	99.9	immunoglobulin ...	Mus musculus
AAL37164	100.0	immunoglobulin ...	Mus musculus
EDL39013	99.9	immunoglobulin ...	Mus musculus
Q05BQ1	99.7	Protein turtle ...	Mus musculus
P0C5H6	95.9	Protein turtle ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220364	3.8e-11	31.7	mKIAA1030
AB093285	1.9e-07	23.5	mKIAA1132
AK129481	0.00015	25.6	mKIAA3016
AK122223	0.00015	26.9	mKIAA0230
AK122252	0.00029	23.4	mKIAA0343

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR003962 572 590 PR00014 Fibronectin

IPR003962 590 604 PR00014 Fibronectin

HMMPfam NULL 14 143 PF07686 NULL

NULL 145 234 PF07686 NULL

NULL 146 234 PF07679 NULL

IPR007110 161 218 PF00047 Immunoglobulin-like

NULL 236 330 PF07686 NULL

NULL 237 330 PF07679 NULL

IPR007110 251 313 PF00047 Immunoglobulin-like

IPR007110 347 407 PF00047 Immunoglobulin-like

NULL 428 514 PF07679 NULL

IPR007110 443 498 PF00047 Immunoglobulin-like

IPR003961 518 606 PF00041 Fibronectin

IPR003961 634 718 PF00041 Fibronectin

HMMSmart IPR003599 36 141 SM00409 Immunoglobulin subtype

IPR003598 42 125 SM00408 Immunoglobulin C2 type

IPR003599 153 234 SM00409 Immunoglobulin subtype

IPR003598 159 223 SM00408 Immunoglobulin C2 type

IPR003599 243 330 SM00409 Immunoglobulin subtype

IPR003598 249 318 SM00408 Immunoglobulin C2 type

IPR003599 339 422 SM00409 Immunoglobulin subtype

IPR003598 345 412 SM00408 Immunoglobulin C2 type

IPR003599 434 514 SM00409 Immunoglobulin subtype

IPR003598 441 503 SM00408 Immunoglobulin C2 type

IPR003961 518 603 SM00060 Fibronectin

IPR003961 634 715 SM00060 Fibronectin

ProfileScan IPR007110 34 120 PS50835 Immunoglobulin-like

IPR007110 146 226 PS50835 Immunoglobulin-like

IPR007110 236 328 PS50835 Immunoglobulin-like

IPR007110 332 420 PS50835 Immunoglobulin-like

IPR007110 428 512 PS50835 Immunoglobulin-like

IPR000694 833 984 PS50099 Proline-rich region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003962	572	590	PR00014	Fibronectin
IPR003962	590	604	PR00014	Fibronectin
HMMPfam	NULL	14	143	PF07686	NULL
NULL	145	234	PF07686	NULL
NULL	146	234	PF07679	NULL
IPR007110	161	218	PF00047	Immunoglobulin-like
NULL	236	330	PF07686	NULL
NULL	237	330	PF07679	NULL
IPR007110	251	313	PF00047	Immunoglobulin-like
IPR007110	347	407	PF00047	Immunoglobulin-like
NULL	428	514	PF07679	NULL
IPR007110	443	498	PF00047	Immunoglobulin-like
IPR003961	518	606	PF00041	Fibronectin
IPR003961	634	718	PF00041	Fibronectin
HMMSmart	IPR003599	36	141	SM00409	Immunoglobulin subtype
IPR003598	42	125	SM00408	Immunoglobulin C2 type
IPR003599	153	234	SM00409	Immunoglobulin subtype
IPR003598	159	223	SM00408	Immunoglobulin C2 type
IPR003599	243	330	SM00409	Immunoglobulin subtype
IPR003598	249	318	SM00408	Immunoglobulin C2 type
IPR003599	339	422	SM00409	Immunoglobulin subtype
IPR003598	345	412	SM00408	Immunoglobulin C2 type
IPR003599	434	514	SM00409	Immunoglobulin subtype
IPR003598	441	503	SM00408	Immunoglobulin C2 type
IPR003961	518	603	SM00060	Fibronectin
IPR003961	634	715	SM00060	Fibronectin
ProfileScan	IPR007110	34	120	PS50835	Immunoglobulin-like
IPR007110	146	226	PS50835	Immunoglobulin-like
IPR007110	236	328	PS50835	Immunoglobulin-like
IPR007110	332	420	PS50835	Immunoglobulin-like
IPR007110	428	512	PS50835	Immunoglobulin-like
IPR000694	833	984	PS50099	Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 6 28 QASWAMIWCLRLTVLSLIISQGA

64 86 VIEWLRFGFLLPIFIQFGLYSPR

743 765 QPVLAGVVGGVCFLGVAVLVSIL

Method	From	To	amino acid sequence
SOSUI	6	28	QASWAMIWCLRLTVLSLIISQGA
64	86	VIEWLRFGFLLPIFIQFGLYSPR
743	765	QPVLAGVVGGVCFLGVAVLVSIL

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	326 bp
Genome contig ID	gi65488608f_172313199
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AAAAACAGGTGAATAATAAATGTCTGGAAACCGTT
Flanking genome sequence (114600 - 114649)	----+--------+--------+--------+--------+----* TCTCTGTCACCTCTCTTTGTGTTTAAGAGAGATGAGGAAGTCCCTGGATA

Gene/Protein Characteristic Table for mKIAA1355

Features of the cloned DNA sequence

Features of the protein sequence