ROUGE

Gene/Protein Characteristic Table for mKIAA1352

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129337
Description :	Leucyl-tRNA synthetase, cytoplasmic.
Clone Name :	mpm11298 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3805 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 171 bp

Genome contig ID gi65551972r_42322990
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
CTAATCTAATAAACTTGCATTTTTTTCACCTTTGG
Flanking genome sequence
(99984 - 99935)
----+----*----+----*----+----*----+----*----+----*
GCCATGTTATTTATTTATTTTTAATAAATAATTGCTGGTCCCTAGAAGTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1352 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1352	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..3634
Length: 1210 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8BMJ2	99.9	Leucyl-tRNA syn...	Mus musculus
BAC27133	99.7	unnamed protein...	Mus musculus
BAC33766	99.7	unnamed protein...	Mus musculus
AAH87655	97.1	Leucyl-tRNA syn...	Rattus norvegicus
BAG37619	90.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002300 51 790 PF00133 Aminoacyl-tRNA synthetase

NULL 828 964 PF08264 NULL

HMMTigr IPR004493 46 1096 TIGR00395 Leucyl-tRNA synthetase archae/euk cytosolic

ScanRegExp IPR001412 87 98 PS00178 Aminoacyl-tRNA synthetase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002300	51	790	PF00133	Aminoacyl-tRNA synthetase
NULL	828	964	PF08264	NULL
HMMTigr	IPR004493	46	1096	TIGR00395	Leucyl-tRNA synthetase archae/euk cytosolic
ScanRegExp	IPR001412	87	98	PS00178	Aminoacyl-tRNA synthetase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	171 bp
Genome contig ID	gi65551972r_42322990
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- CTAATCTAATAAACTTGCATTTTTTTCACCTTTGG
Flanking genome sequence (99984 - 99935)	----+--------+--------+--------+--------+----* GCCATGTTATTTATTTATTTTTAATAAATAATTGCTGGTCCCTAGAAGTT

Gene/Protein Characteristic Table for mKIAA1352

Features of the cloned DNA sequence

Features of the protein sequence