Order Kazusa clone(s) from : ![]() |
Product ID | ORK01162 |
---|---|
Accession No | AB037773 |
Description | leucyl-tRNA synthetase |
Clone name | fj01313 |
Vector information | |
cDNA sequence | DNA sequence (3893 bp) Predicted protein sequence (1212 aa) |
HaloTag ORF Clone |
FHC01162
![]() |
Flexi ORF Clone | FXC01162 |
Source | Human fetal brain |
Rouge ID |
mKIAA1352
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 195 bp |
---|---|
Genome contig ID | gi51511721r_145373682 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99985 - 99936) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | r | 145473667 | 145542416 | 32 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | ATGCTGTTTTCAATGTGGACC |
---|---|
Primer_r | CCAATCAGTAGACACAATCAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |