ROUGE |
Gene/Protein Characteristic Table for mKIAA1247 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129316 |
---|---|
Extracellular sulfatase Sulf-2 precursor. | |
mpm06364 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3925 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 866 bp Genome contig ID gi66880554r_165430679 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TATTGGTATGAAAAAAAAAATCTTTGAATTTTTGTFlanking genome sequence
(99975 - 99926) ----+----*----+----*----+----*----+----*----+----*
AAAAGGCTATCTTGGGACTTTTTTGCTCTTTATTATTATCATTTTTTTCT
KIAA Alignment based on: KIAA1247 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 213..3059
Length: 948 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |