ROUGE

Gene/Protein Characteristic Table for mKIAA1241

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220262
Description :
Clone Name :	mia21003 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 8166 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2282 bp

Genome contig ID gi65535943r_96112945
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GATAAAAATTATGTAAATAAAAGTTATTTTATACC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTCTTGTTTTGTCCTTTTCAAACAACAAAGGCATTAATGATGCTAATGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1241 DNA sequence

KIAA	Alignment based on:
KIAA1241	DNA sequence

Features of the protein sequence	Description

Coding region: 2..5881
Length: 1960 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q571C7	99.9	Transcription f...	Mus musculus
EDL00825	99.8	mCG116166 [Mus ...	Mus musculus
EDM10187	77.3	B double prime ...	Rattus norvegicus
AAI44853	99.9	Bdp1 protein [M...	Mus musculus
XP_001093653	49.4	similar to tran...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 385 661 PS50313 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	385	661	PS50313	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2282 bp
Genome contig ID	gi65535943r_96112945
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GATAAAAATTATGTAAATAAAAGTTATTTTATACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCTTGTTTTGTCCTTTTCAAACAACAAAGGCATTAATGATGCTAATGT

Gene/Protein Characteristic Table for mKIAA1241

Features of the cloned DNA sequence

Features of the protein sequence