ROUGE

Gene/Protein Characteristic Table for mKIAA1236

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129315
Description :	Kinesin superfamily protein 26A (Fragment).
Clone Name :	mpm04158 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 5042 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1112 bp

Genome contig ID gi65532617f_107553505
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTTTTATTTGTGAATAAAAGATGTGTTGATTGTTT
Flanking genome sequence
(107590 - 107639)
----+----*----+----*----+----*----+----*----+----*
ATATGGTTCTGACTTTCCGGGGTGCCCCTGAGCCTTTTACCCCTGATGTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1236 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1236	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..3930
Length: 1309 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL18598	99.5	mCG1692 [Mus mu...	Mus musculus
Q52KG5	99.4	Kinesin-like pr...	Mus musculus
XP_234565	91.9	similar to CG14...	Rattus norvegicus
AAH94358	99.4	Kif26a protein ...	Mus musculus
EAW81861	74.7	hCG22909, isofo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220558	3.1e-05	25.6	mKIAA4231

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR001752 3 153 SM00129 Kinesin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001752	3	153	SM00129	Kinesin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1112 bp
Genome contig ID	gi65532617f_107553505
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTTTTATTTGTGAATAAAAGATGTGTTGATTGTTT
Flanking genome sequence (107590 - 107639)	----+--------+--------+--------+--------+----* ATATGGTTCTGACTTTCCGGGGTGCCCCTGAGCCTTTTACCCCTGATGTG

Gene/Protein Characteristic Table for mKIAA1236

Features of the cloned DNA sequence

Features of the protein sequence