ROUGE

Gene/Protein Characteristic Table for mKIAA1235

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129314
Description :
Clone Name :	mpk02075 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 1455 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 174 bp

Genome contig ID gi65550231f_5149172
PolyA signal sequence
(ATTAAA,-32)
+----*----+----*----+----*----+----
GGAATTAAATCATTAATTTGAACAGTTATAAAATT
Flanking genome sequence
(101467 - 101516)
----+----*----+----*----+----*----+----*----+----*
AATATTTGCTGTCTGTGTGTATAAGTACATCCTCTGGCGGTTTTCTGTTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1235 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1235	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1281
Length: 426 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE24141	7.8e-180	98.1	unnamed protein...	Mus musculus
EDL01654	2e-179	98.1	mCG5693 [Mus mu...	Mus musculus
NP_001078824	2.6e-179	98.1	AT rich interac...	Mus musculus
XP_001066861	7e-177	96.7	similar to tran...	Rattus norvegicus
CAC43233	1.8e-176	96.5	6A3-5 protein [...	Rattus rattus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	174 bp
Genome contig ID	gi65550231f_5149172
PolyA signal sequence (ATTAAA,-32)	+--------+--------+----*----+---- GGAATTAAATCATTAATTTGAACAGTTATAAAATT
Flanking genome sequence (101467 - 101516)	----+--------+--------+--------+--------+----* AATATTTGCTGTCTGTGTGTATAAGTACATCCTCTGGCGGTTTTCTGTTT

Gene/Protein Characteristic Table for mKIAA1235

Features of the cloned DNA sequence

Features of the protein sequence