ROUGE

Gene/Protein Characteristic Table for mKIAA1234

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173134
Description :	aryl-hydrocarbon receptor repressor.
Clone Name :	mfj26053 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 5099 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4470 bp

Genome contig ID gi65535943r_70178144
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTAATTAGCTTTGCATTAGACCTTAAAAGTTCTAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGAAAAAAAAAACTCTGCAAAATAAGGATTAAAAGGTGTAAGAGTTAAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1234 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1234	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..629
Length: 208 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAA37132	3.4e-94	100.0	AhR repressor [...	Mus musculus
Q3U1U7	3.4e-94	100.0	Aryl hydrocarbo...	Mus musculus
BAE32810	3.4e-94	100.0	unnamed protein...	Mus musculus
Q75NT5	8.5e-93	98.6	Aryl hydrocarbo...	Rattus norvegicus
AAI18535	9.8e-77	100.0	Ahrr protein [M...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000014 17 134 PF00989 PAS

HMMSmart IPR000014 17 83 SM00091 PAS

ProfileScan IPR000014 20 85 PS50112 PAS

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000014	17	134	PF00989	PAS
HMMSmart	IPR000014	17	83	SM00091	PAS
ProfileScan	IPR000014	20	85	PS50112	PAS

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4470 bp
Genome contig ID	gi65535943r_70178144
PolyA signal sequence (None)	+--------+--------+----*----+---- TTAATTAGCTTTGCATTAGACCTTAAAAGTTCTAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGAAAAAAAAAACTCTGCAAAATAAGGATTAAAAGGTGTAAGAGTTAAT

Gene/Protein Characteristic Table for mKIAA1234

Features of the cloned DNA sequence

Features of the protein sequence