ROUGE

Gene/Protein Characteristic Table for mKIAA1217

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093289
Description :	sickle tail isoform a. sickle tail.
Clone Name :	mpm09263 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4572 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1314 bp

Genome contig ID gi66880554f_20461790
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GGAAGGATGAATTCCTAATAAACTCATCAACCATG
Flanking genome sequence
(390747 - 390796)
----+----*----+----*----+----*----+----*----+----*
TGGCCGTCTGGACTTCCTTTCCTGCCTGACTCTTCTCTAGGGCATGGGGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1217 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1217	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 97..3258
Length: 1053 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD14930	0	77.3	Sickle tail-b [...	Mus musculus
BAD14929	0	76.7	Sickle tail-a [...	Mus musculus
AAI44228	0	66.6	KIAA1217 protei...	Homo sapiens
NP_001091971	0	68.6	sickle tail iso...	Homo sapiens
XP_858274	7.3e-210	73.2	similar to p130...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129422	1.8e-15	36.2	mKIAA1684

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR000694 311 377 PS50099 Proline-rich region

NULL 903 1015 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000694	311	377	PS50099	Proline-rich region
NULL	903	1015	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1314 bp
Genome contig ID	gi66880554f_20461790
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GGAAGGATGAATTCCTAATAAACTCATCAACCATG
Flanking genome sequence (390747 - 390796)	----+--------+--------+--------+--------+----* TGGCCGTCTGGACTTCCTTTCCTGCCTGACTCTTCTCTAGGGCATGGGGG

Gene/Protein Characteristic Table for mKIAA1217

Features of the cloned DNA sequence

Features of the protein sequence