ROUGE

Gene/Protein Characteristic Table for mKIAA1191

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173126
Description :
Clone Name :	mbj00877 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 2580 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1387 bp

Genome contig ID gi65535943r_53060980
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTGTATTGACAAATAAAAATCTTTACTACTTTCTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGCCCAGGTCTGTCTTGTCCATTCTGCCTGCCCCATAGTGGAGCCCAAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1191 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1191	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 183..1193
Length: 336 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE39669	2.5e-105	99.7	unnamed protein...	Mus musculus
BAE26191	6.1e-105	99.7	unnamed protein...	Mus musculus
EDL41142	2.2e-102	95.5	RIKEN cDNA 4833...	Mus musculus
EDL41141	1.8e-98	100.0	RIKEN cDNA 4833...	Mus musculus
EDL94048	1.1e-94	95.1	hypothetical LO...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1387 bp
Genome contig ID	gi65535943r_53060980
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTGTATTGACAAATAAAAATCTTTACTACTTTCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCCCAGGTCTGTCTTGTCCATTCTGCCTGCCCCATAGTGGAGCCCAAG

Gene/Protein Characteristic Table for mKIAA1191

Features of the cloned DNA sequence

Features of the protein sequence