Order Kazusa clone(s) from : ![]() |
Product ID | ORK05641 |
---|---|
Accession No | AB033017 |
Description | KIAA1191 |
Clone name | hh01795a |
Vector information | |
cDNA sequence | DNA sequence (1837 bp) Predicted protein sequence (100 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1191
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1533 bp |
---|---|
Genome contig ID | gi51511721r_175605674 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | r | 175705674 | 175707624 | 2 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TGCTCCAGCCTTATCAGTTAG |
---|---|
Primer_r | ATGAAGAACTAGCTGCAAGAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |