ROUGE

Gene/Protein Characteristic Table for mKIAA1182

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173124
Description :	Negative elongation factor B.
Clone Name :	mpj00185 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2165 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 601 bp

Genome contig ID gi66880554r_25031882
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AATTTTCCACTTATGTAAATAAAACGGATTTTGAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATCCATGGTGAGGAATCTGTTTGTCCTGGGACTGGGTTCAGTGGTGGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1182 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1182	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1564
Length: 520 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8C4Y3	0	100.0	Negative elonga...	Mus musculus
EDL93635	1.2e-214	98.5	similar to cofa...	Rattus norvegicus
Q8WX92	3e-210	95.4	Negative elonga...	Homo sapiens
XP_590381	1.5e-208	94.8	cofactor of BRC...	Bos taurus
XP_548351	5.5e-207	94.4	similar to cofa...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010405 46 520 PF06209 Cofactor of BRCA1

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010405	46	520	PF06209	Cofactor of BRCA1

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	601 bp
Genome contig ID	gi66880554r_25031882
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AATTTTCCACTTATGTAAATAAAACGGATTTTGAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATCCATGGTGAGGAATCTGTTTGTCCTGGGACTGGGTTCAGTGGTGGA

Gene/Protein Characteristic Table for mKIAA1182

Features of the cloned DNA sequence

Features of the protein sequence