ROUGE

Gene/Protein Characteristic Table for mKIAA1158

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173115
Description :	Sodium channel beta-3 subunit precursor.
Clone Name :	mfj07349 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4025 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3088 bp

Genome contig ID gi65519420f_40119629
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TCTCTGTTCATGTCAATAAAGCATCTCTGAAGACC
Flanking genome sequence
(122280 - 122329)
----+----*----+----*----+----*----+----*----+----*
ACTTGCTCTGGGTTTGCTATGCTTTACAACCTGCGGCTGCTGTCCCCTCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1158 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1158	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 131..937
Length: 268 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL25513	2.1e-96	100.0	sodium channel,...	Mus musculus
XP_001104555	6e-93	85.2	similar to Sodi...	Macaca mulatta
Q8BHK2	2.5e-92	100.0	Sodium channel ...	Mus musculus
Q9JK00	6.6e-92	99.5	Sodium channel ...	Rattus norvegicus
AAL07512	9.1e-92	99.5	brain and heart...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam NULL 75 196 PF07686 NULL

HMMSmart IPR003599 83 193 SM00409 Immunoglobulin subtype

ProfileScan IPR007110 77 211 PS50835 Immunoglobulin-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	NULL	75	196	PF07686	NULL
HMMSmart	IPR003599	83	193	SM00409	Immunoglobulin subtype
ProfileScan	IPR007110	77	211	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 209 231 VVSEIMMYILLVFLTLWLFIEMI

Method	From	To	amino acid sequence
SOSUI	209	231	VVSEIMMYILLVFLTLWLFIEMI

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3088 bp
Genome contig ID	gi65519420f_40119629
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TCTCTGTTCATGTCAATAAAGCATCTCTGAAGACC
Flanking genome sequence (122280 - 122329)	----+--------+--------+--------+--------+----* ACTTGCTCTGGGTTTGCTATGCTTTACAACCTGCGGCTGCTGTCCCCTCT

Gene/Protein Characteristic Table for mKIAA1158

Features of the cloned DNA sequence

Features of the protein sequence