ROUGE |
Gene/Protein Characteristic Table for mKIAA1158 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173115 |
---|---|
Sodium channel beta-3 subunit precursor. | |
mfj07349 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4025 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3088 bp Genome contig ID gi65519420f_40119629 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TCTCTGTTCATGTCAATAAAGCATCTCTGAAGACCFlanking genome sequence
(122280 - 122329) ----+----*----+----*----+----*----+----*----+----*
ACTTGCTCTGGGTTTGCTATGCTTTACAACCTGCGGCTGCTGTCCCCTCT
KIAA Alignment based on: KIAA1158 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 131..937
Length: 268 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | NULL | 75 | 196 | PF07686 | NULL |
HMMSmart | IPR003599 | 83 | 193 | SM00409 | Immunoglobulin subtype |
ProfileScan | IPR007110 | 77 | 211 | PS50835 | Immunoglobulin-like |
Method | From | To | amino acid sequence |
---|---|---|---|
SOSUI | 209 | 231 | VVSEIMMYILLVFLTLWLFIEMI |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |