ROUGE

Gene/Protein Characteristic Table for mKIAA1155

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173114
Description :
Clone Name :	mtj01476 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 3261 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2772 bp

Genome contig ID gi65504368r_84050401
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AACCATGGCTTAAAAATAAATGGTTTTGGTGAACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTAAATGTTTTCCAGGTTATTGTTATGTCAAGTTTTTTTTTTTTGTTTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1155 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1155	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..489
Length: 162 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_232121	8.2e-66	98.1	similar to Poly...	Rattus norvegicus
Q91W45	5.3e-54	100.0	Polyadenylate-b...	Mus musculus
EDL91170	6.2e-54	99.3	similar to hypo...	Rattus norvegicus
BAC32533	1.2e-53	99.3	unnamed protein...	Mus musculus
EDK99110	4.7e-49	100.0	cDNA sequence B...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR009818 144 161 PF07145 Ataxin-2

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009818	144	161	PF07145	Ataxin-2

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2772 bp
Genome contig ID	gi65504368r_84050401
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AACCATGGCTTAAAAATAAATGGTTTTGGTGAACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTAAATGTTTTCCAGGTTATTGTTATGTCAAGTTTTTTTTTTTTGTTTT

Gene/Protein Characteristic Table for mKIAA1155

Features of the cloned DNA sequence

Features of the protein sequence