ROUGE |
Gene/Protein Characteristic Table for mKIAA1147 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122457 |
---|---|
mbg02219 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6438 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 5364 bp Genome contig ID gi65504368r_40442957 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GAAATTTTTACAATTAATGTTCACATTTTAACATGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGCCTGTGTGCTGTGATCTTTTACCATGTAGTTTTTGGTAGGAAGGAATG
KIAA Alignment based on: KIAA1147 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 1..1074
Length: 357 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |