ROUGE

Gene/Protein Characteristic Table for mKIAA1121

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122453
Description :	Ca<2+>dependent activator protein for secretion. Ca2+-dependent activator protein for secretion.
Clone Name :	mbg08947 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5459 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1050 bp

Genome contig ID gi65540054r_10730060
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TGTGGCTCCTCAATAAATAATTATTCAAATGTCCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGAATGTGTGTGTGTGAGCTCATCTTCTTCCATCTCCTTTGAAAGCCCA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1121 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1121	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 231..4409
Length: 1392 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q80TJ1	99.9	Calcium-depende...	Mus musculus
NP_001036082	99.9	Cadependent act...	Mus musculus
Q9ULU8	98.7	Calcium-depende...	Homo sapiens
XP_001174522	98.3	similar to muta...	Pan troglodytes
ABC61313	98.0	mutant Ca2+-dep...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000008 435 516 PF00168 C2

IPR001849 557 659 PF00169 Pleckstrin-like

IPR010439 874 979 PF06292 Protein of unknown function DUF1041

HMMSmart IPR001849 557 661 SM00233 Pleckstrin-like

ProfileScan NULL 78 122 PS50315 NULL

IPR001849 556 659 PS50003 Pleckstrin-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	435	516	PF00168	C2
IPR001849	557	659	PF00169	Pleckstrin-like
IPR010439	874	979	PF06292	Protein of unknown function DUF1041
HMMSmart	IPR001849	557	661	SM00233	Pleckstrin-like
ProfileScan	NULL	78	122	PS50315	NULL
IPR001849	556	659	PS50003	Pleckstrin-like

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1050 bp
Genome contig ID	gi65540054r_10730060
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TGTGGCTCCTCAATAAATAATTATTCAAATGTCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGAATGTGTGTGTGTGAGCTCATCTTCTTCCATCTCCTTTGAAAGCCCA

Gene/Protein Characteristic Table for mKIAA1121

Features of the cloned DNA sequence

Features of the protein sequence