KIAA1121

Product ID	ORK04421
Accession No	AB032947
Description	Ca++-dependent secretion activator, transcript variant 1
Clone name	hh10147
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5471 bp) Predicted protein sequence (1390 aa)
HaloTag ORF Clone	FHC04421
Flexi ORF Clone	FXC04421
Source	Human adult brain
Rouge ID	mKIAA1121 by Kazusa Mouse cDNA Project
Note	We replaced hj00332, former representative clones for KIAA1121 with hh10147. (2001/5/29)

Length: 5471 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	1059 bp
Genome contig ID	gi89161205r_62259062
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- GCTTCTCAATAAATATTCAGATGTCCTAAGAATAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACGTTTGGGTCTGTCTTCCTCTGTCTACTTTGAATGCCAGAACTGAAACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	62359062	62836094	29	99.5	Perfect prediction

Length: 1390 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULU8	99.9	Calcium-depende...	Homo sapiens
XP_001174522	99.5	similar to muta...	Pan troglodytes
Q80TJ1	98.7	Calcium-depende...	Mus musculus
NP_001036082	98.7	Cadependent act...	Mus musculus
ABC61313	98.8	mutant Ca2+-dep...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046811	8.7e-102	75.8	KIAA1591

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	437	518	PF00168	C2 calcium-dependent membrane targeting
	IPR001849	559	661	PF00169	Pleckstrin-like
	IPR010439	872	977	PF06292	Protein of unknown function DUF1041
HMMSmart	IPR001849	559	663	SM00233	Pleckstrin-like
ProfileScan	IPR001849	558	661	PS50003	Pleckstrin-like
ProfileScan	IPR014770	968	1148	PS51258	Munc13 homology 1

Primer_f	AAAAATGAACCCCTTGTGTCG
Primer_r	ACACAGTTGAGACGTAAAAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAAAATGAACCCCTTGTGTCG
Primer_r	ACACAGTTGAGACGTAAAAGC
PCR product length	224 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles