ROUGE

Gene/Protein Characteristic Table for mKIAA1080

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129280
Description :
Clone Name :	mpj01355 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2806 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 925 bp

Genome contig ID gi65511124r_115766625
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AGTACAGAACATCATTGAATAAATACTGTGTTCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCTGCCTGGTGTTGAGTCCACAGGGGATGCATTTAGAGGGGACAGGCTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1080 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1080	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 43..1881
Length: 612 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6P5E6	100.0	ADP-ribosylatio...	Mus musculus
BAE35509	99.8	unnamed protein...	Mus musculus
BAE29092	99.8	unnamed protein...	Mus musculus
BAB23426	99.7	unnamed protein...	Mus musculus
EDM17574	96.9	golgi associate...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122212	1.3e-48	41.3	mKIAA0154

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002014 38 185 PD003686 VHS

IPR008153 476 604 PD021457 Gamma-adaptin

HMMPfam IPR002014 30 171 PF00790 VHS

IPR004152 234 335 PF03127 GAT

IPR008152 480 604 PF02883 Alpha/gamma adaptin

HMMSmart IPR002014 38 171 SM00288 VHS

ProfileScan IPR002014 45 175 PS50179 VHS

IPR008153 487 598 PS50180 Gamma-adaptin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002014	38	185	PD003686	VHS
IPR008153	476	604	PD021457	Gamma-adaptin
HMMPfam	IPR002014	30	171	PF00790	VHS
IPR004152	234	335	PF03127	GAT
IPR008152	480	604	PF02883	Alpha/gamma adaptin
HMMSmart	IPR002014	38	171	SM00288	VHS
ProfileScan	IPR002014	45	175	PS50179	VHS
IPR008153	487	598	PS50180	Gamma-adaptin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	925 bp
Genome contig ID	gi65511124r_115766625
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AGTACAGAACATCATTGAATAAATACTGTGTTCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTGCCTGGTGTTGAGTCCACAGGGGATGCATTTAGAGGGGACAGGCTG

Gene/Protein Characteristic Table for mKIAA1080

Features of the cloned DNA sequence

Features of the protein sequence