ROUGE

Gene/Protein Characteristic Table for mKIAA0994

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	D16580
Description :	Protein-arginine deiminase type II.
Clone Name :	mbh02401 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 3825 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2654 bp

Genome contig ID gi65493515f_139714007
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CAAAATAAAGAGCAATAAAATAAGCCGTCCACGGG
Flanking genome sequence
(119837 - 119886)
----+----*----+----*----+----*----+----*----+----*
AAGCTACGCGGCTCTGGGTGACATTCTTTGCGGCTTCTGAGACATAGACA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0994 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0994	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1171
Length: 389 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q08642	2.2e-177	100.0	Protein-arginin...	Mus musculus
EDL13330	4.1e-177	99.7	peptidyl argini...	Mus musculus
XP_920232	4.4e-177	99.7	similar to pept...	Mus musculus
BAD16624	5e-177	99.7	peptidylarginin...	Mus musculus
EDL80950	1.3e-173	97.4	peptidyl argini...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220522	2.8e-110	62.5	mKIAA4171

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004303 1 389 PF03068 Protein-arginine deiminase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004303	1	389	PF03068	Protein-arginine deiminase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2654 bp
Genome contig ID	gi65493515f_139714007
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CAAAATAAAGAGCAATAAAATAAGCCGTCCACGGG
Flanking genome sequence (119837 - 119886)	----+--------+--------+--------+--------+----* AAGCTACGCGGCTCTGGGTGACATTCTTTGCGGCTTCTGAGACATAGACA

Gene/Protein Characteristic Table for mKIAA0994

Features of the cloned DNA sequence

Features of the protein sequence