ROUGE

Gene/Protein Characteristic Table for mKIAA0975

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122412
Description :	nischarin. imidazoline receptor I-1-like protein.
Clone Name :	mbg09869 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5080 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 636 bp

Genome contig ID gi65540054r_29202771
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TACGTTCTCTATTCTAATAAAATGGAGTTTGACAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACATGAGTCTTCAAGGTTATAGAGAACTGGGGTCCCAAAAGGGCTTCAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0975 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0975	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..4444
Length: 1480 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q80TM9	0	90.0	Nischarin; Imid...	Mus musculus
AAI44981	0	88.7	Nisch protein [...	Mus musculus
AAI08365	0	87.1	Nisch protein [...	Mus musculus
AAG42100	1.3e-178	87.7	nischarin [Mus ...	Mus musculus
EDL24794	1.3e-178	88.6	nischarin [Mus ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122388	3.5e-06	35.8	mKIAA0845

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 337 350 PR00019 Leucine-rich repeat

IPR001611 379 392 PR00019 Leucine-rich repeat

IPR000104 973 987 PR00308 Antifreeze protein

IPR000104 987 998 PR00308 Antifreeze protein

IPR000104 999 1008 PR00308 Antifreeze protein

HMMPfam IPR001683 61 165 PF00787 Phox-like

IPR001611 336 358 PF00560 Leucine-rich repeat

IPR001611 359 380 PF00560 Leucine-rich repeat

IPR001611 381 404 PF00560 Leucine-rich repeat

HMMSmart IPR001683 61 165 SM00312 Phox-like

ProfileScan IPR001683 58 168 PS50195 Phox-like

NULL 524 584 PS50313 NULL

IPR000694 933 1069 PS50099 Proline-rich region

NULL 934 1080 PS50310 NULL

ScanRegExp IPR001128 696 705 PS00086 Cytochrome P450

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	337	350	PR00019	Leucine-rich repeat
IPR001611	379	392	PR00019	Leucine-rich repeat
IPR000104	973	987	PR00308	Antifreeze protein
IPR000104	987	998	PR00308	Antifreeze protein
IPR000104	999	1008	PR00308	Antifreeze protein
HMMPfam	IPR001683	61	165	PF00787	Phox-like
IPR001611	336	358	PF00560	Leucine-rich repeat
IPR001611	359	380	PF00560	Leucine-rich repeat
IPR001611	381	404	PF00560	Leucine-rich repeat
HMMSmart	IPR001683	61	165	SM00312	Phox-like
ProfileScan	IPR001683	58	168	PS50195	Phox-like
NULL	524	584	PS50313	NULL
IPR000694	933	1069	PS50099	Proline-rich region
NULL	934	1080	PS50310	NULL
ScanRegExp	IPR001128	696	705	PS00086	Cytochrome P450

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	636 bp
Genome contig ID	gi65540054r_29202771
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TACGTTCTCTATTCTAATAAAATGGAGTTTGACAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACATGAGTCTTCAAGGTTATAGAGAACTGGGGTCCCAAAAGGGCTTCAA

Gene/Protein Characteristic Table for mKIAA0975

Features of the cloned DNA sequence

Features of the protein sequence