ROUGE

Gene/Protein Characteristic Table for mKIAA0948

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129245
Description :	transforming growth factor beta regulated gene 4. cell cycle progression 2 protein.
Clone Name :	mpj00976 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2267 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 188 bp

Genome contig ID gi65527427r_6411214
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AATGGGTGGTCCTAATAAATCCTTTGGTTTGGTGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGCCAGCTATCTTCCCAGGCTCTGTATCTATCTCCTCTCTCTCGTATTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0948 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0948	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 112..2079
Length: 655 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL01235	0	99.8	mCG21397, isofo...	Mus musculus
Q91YM4	0	100.0	Protein TBRG4; ...	Mus musculus
Q5M9G9	0	92.5	Protein TBRG4; ...	Rattus norvegicus
BAE38999	0	95.1	unnamed protein...	Mus musculus
XP_001475770	6.4e-208	100.0	similar to Tran...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220423	1.1e-05	24.6	mKIAA1800

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010622 392 560 PF06743 FAST kinase leucine-rich

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010622	392	560	PF06743	FAST kinase leucine-rich

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	188 bp
Genome contig ID	gi65527427r_6411214
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AATGGGTGGTCCTAATAAATCCTTTGGTTTGGTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCCAGCTATCTTCCCAGGCTCTGTATCTATCTCCTCTCTCTCGTATTT

Gene/Protein Characteristic Table for mKIAA0948

Features of the cloned DNA sequence

Features of the protein sequence