ROUGE |
Gene/Protein Characteristic Table for mKIAA0947 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129244 |
---|---|
mpf00528 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6103 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 903 bp Genome contig ID gi65535943r_66540396 PolyA signal sequence
(AATAAA,-16) +----*----+----*----+----*----+----
ATGTGTTTTTATAATAAAAAATAAAAGCAAGCCATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACACACTGTTGTGATTGTTTTATGTGGTGCTTGATGTCCCATCTGTAGTG
KIAA Alignment based on: KIAA0947 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 2..5200
Length: 1732 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |