Gene/Protein Characteristic Table for KIAA0947
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01137
Accession No AB023164
Description interactor of little elongation complex ELL subunit 1
Clone name ef03552
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
cDNA sequence DNA sequence (7903 bp)
Predicted protein sequence (2330 aa)
Source
Rouge ID mKIAA0947 by Kazusa Mouse cDNA Project
Note We replaced hj04847 and hj04847s1, former representative clones for KIAA0947 with ef03552. (2002/5/10,2005/08/06)
Features of the cloned cDNA sequence
Description

Length: 7903 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 880 bp
Genome contig ID gi51511721f_5375807
PolyA signal sequence
(AATAAA,-9)		 
+----*----+----*----+----*----+----
CTCTTGTATGTGTTTTTATAATAAAAAATAAAAGT
Flanking genome sequence
(167518 - 167567)		 
----+----*----+----*----+----*----+----*----+----*
AAGCCATGGATATTACTGTTCTGATTATTAGAGTGAAACTGGGTGTTACT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 5 f 5475807 5543323 18 99.3 Perfect prediction
Features of the protein sequence
Description

Length: 2330 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
NP_056140 0 99.9 hypothetical pr...
 Homo sapiens
CAH18279 0 99.8 hypothetical pr...
 Homo sapiens
CAD97966 0 99.9 hypothetical pr...
 Homo sapiens
EAX08113 0 100.0 hCG16543 [Homo ...
 Homo sapiens
XP_545182 0 63.5 similar to muci...
 Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GCTGTTGTTGTTGGACTTGTG
Primer_r AAGTGGGTTTCTGCTAAGGGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 5
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp