ROUGE

Gene/Protein Characteristic Table for mKIAA0933

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122403
Description :
Clone Name :	mbg10560 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4912 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 240 bp

Genome contig ID gi65546577f_92826652
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
GTAATGGAAATAAAATTAACATATCATCTAACCAC
Flanking genome sequence
(153690 - 153739)
----+----*----+----*----+----*----+----*----+----*
ACGTAATTGTCATGTGTATAGATTAAGGTCTTTTGTTTGCTGAGCAAATA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0933 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0933	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..4672
Length: 1556 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q3UHQ6	100.0	Protein dopey-2.	Mus musculus
NP_081569	100.0	pad-1-like isof...	Mus musculus
BAE27979	99.9	unnamed protein...	Mus musculus
BAE27801	99.8	unnamed protein...	Mus musculus
XP_001055500	95.6	similar to pad-...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173101	9.5e-11	34.6	mKIAA1117

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	240 bp
Genome contig ID	gi65546577f_92826652
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- GTAATGGAAATAAAATTAACATATCATCTAACCAC
Flanking genome sequence (153690 - 153739)	----+--------+--------+--------+--------+----* ACGTAATTGTCATGTGTATAGATTAAGGTCTTTTGTTTGCTGAGCAAATA

Gene/Protein Characteristic Table for mKIAA0933

Features of the cloned DNA sequence

Features of the protein sequence