KIAA0907

Gene/Protein Characteristic Table for KIAA0907

Order Kazusa clone(s) from :

Product ID	ORK00679
Accession No	AB020714
Description	KIAA0907
Clone name	hk10396
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4500 bp) Predicted protein sequence (569 aa)
HaloTag ORF Clone	FHC00679
Flexi ORF Clone	FXC00679
Source	Human adult brain
Rouge ID	mKIAA0907 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4500 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2779 bp
Genome contig ID	gi89161185r_154049460
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CCATAATTTCATTATAAATAAATCTATAAATATTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGCTTGTGGTTTCTCTGTTTTCTTCCACAACCCATCCATACACTGAAATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	154149460	154170814	13	99.3	Perfect prediction

Features of the protein sequence

Description

Length: 569 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001116302	2e-159	99.8	hypothetical pr...	Macaca mulatta
EDM00691	5.4e-151	96.9	similar to RIKE...	Rattus norvegicus
EDM00692	5.6e-151	96.9	similar to RIKE...	Rattus norvegicus
XP_864557	5.7e-151	95.7	hypothetical pr...	Canis lupus fam...
AAH92205	1e-150	96.5	LOC361980 prote...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TGCATCCCTGTTTTGTTTTGG
Primer_r	GCTATGAGACCAATGTGCCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 1

Experimental conditions

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp