ROUGE |
Gene/Protein Characteristic Table for mKIAA0899 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173054 |
---|---|
Adapter-related protein complex 2 alpha 2 subunit. | |
msh07103 [Vector Info] | |
Source : | Mouse adult spleen |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3214 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 280 bp Genome contig ID gi65511124f_135865079 PolyA signal sequence
(ATTAAA,-23) +----*----+----*----+----*----+----
TTCAACCTACAAATTAAAGGGAAATTAGAAGTTTGFlanking genome sequence
(169409 - 169458) ----+----*----+----*----+----*----+----*----+----*
AACGAAAGTGGAAATTTTGTTCAAATTTTATTAAAATGCCACTGGCTCAA
KIAA Alignment based on: KIAA0899 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 31..2934
Length: 967 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |