ROUGE

Gene/Protein Characteristic Table for mKIAA0899

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173054
Description :	Adapter-related protein complex 2 alpha 2 subunit.
Clone Name :	msh07103 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 3214 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 280 bp

Genome contig ID gi65511124f_135865079
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
TTCAACCTACAAATTAAAGGGAAATTAGAAGTTTG
Flanking genome sequence
(169409 - 169458)
----+----*----+----*----+----*----+----*----+----*
AACGAAAGTGGAAATTTTGTTCAAATTTTATTAAAATGCCACTGGCTCAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0899 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0899	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 31..2934
Length: 967 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC40392	100.0	unnamed protein...	Mus musculus
AAH58099	99.9	Adaptor protein...	Mus musculus
P18484	99.8	AP-2 complex su...	Rattus norvegicus
BAE31240	99.8	unnamed protein...	Mus musculus
P17427	99.8	AP-2 complex su...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002553 58 619 PF01602 Adaptin

IPR008152 735 848 PF02883 Alpha/gamma adaptin

IPR003164 854 966 PF02296 AP2 clathrin adaptin

ProfileScan NULL 4 26 PS50323 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002553	58	619	PF01602	Adaptin
IPR008152	735	848	PF02883	Alpha/gamma adaptin
IPR003164	854	966	PF02296	AP2 clathrin adaptin
ProfileScan	NULL	4	26	PS50323	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	280 bp
Genome contig ID	gi65511124f_135865079
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- TTCAACCTACAAATTAAAGGGAAATTAGAAGTTTG
Flanking genome sequence (169409 - 169458)	----+--------+--------+--------+--------+----* AACGAAAGTGGAAATTTTGTTCAAATTTTATTAAAATGCCACTGGCTCAA

Gene/Protein Characteristic Table for mKIAA0899

Features of the cloned DNA sequence

Features of the protein sequence