Gene/Protein Characteristic Table for mKIAA0885

Length: 4010 bp

Restriction map

Length of 3'UTR	1248 bp
Genome contig ID	gi65492966f_102356695
PolyA signal sequence (AATAAA,-24)	+----*----+----*----+----*----+---- GAATGGAAGCGAATAAAGTTTTACTGATTTTTGAG
Flanking genome sequence (129394 - 129443)	----+----*----+----*----+----*----+----*----+----* ACACTAGCACCTAGCGCTTTCATTATTGAAATGGGGGCGGGGCGGGGCTG

KIAA	Alignment based on:
KIAA0885	DNA sequence, AA sequence, Physical map

Coding region: 294..2762

Length: 822 aa

Entry Exp ID% Protein Source EDL07605 0 99.8 cold shock doma... Mus musculus AAH29688 0 100.0 Csde1 protein [... Mus musculus BAE32354 0 99.9 unnamed protein... Mus musculus BAE34939 0 99.9 unnamed protein... Mus musculus EDL85499 0 99.3 upstream of NRA... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

No significant homologues

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002059	80	145	PF00313	Cold-shock protein
	IPR002059	209	272	PF00313	Cold-shock protein
	IPR002059	372	437	PF00313	Cold-shock protein
	IPR002059	542	606	PF00313	Cold-shock protein
	IPR002059	697	762	PF00313	Cold-shock protein
HMMSmart	IPR011129	82	145	SM00357	Cold shock protein
	IPR011129	211	272	SM00357	Cold shock protein
	IPR011129	374	437	SM00357	Cold shock protein
	IPR011129	544	606	SM00357	Cold shock protein
	IPR011129	699	762	SM00357	Cold shock protein
ProfileScan	NULL	5	29	PS50314	NULL
ScanRegExp	IPR002059	92	111	PS00352	Cold-shock protein
	IPR002016	98	109	PS00436	Haem peroxidase
	IPR002059	221	240	PS00352	Cold-shock protein
	IPR002059	384	403	PS00352	Cold-shock protein
	IPR002059	554	573	PS00352	Cold-shock protein

Method	From	To	amino acid sequence
-	-	-	-