ROUGE

Gene/Protein Characteristic Table for mKIAA0865

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220356
Description :
Clone Name :	mbp09319 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 3583 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 29 bp

Genome contig ID gi65515060f_9709169
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATGTGATCCAGCGTGGACTGTGGGCACCTGTCTGA
Flanking genome sequence
(292443 - 292492)
----+----*----+----*----+----*----+----*----+----*
GCTGTCTAGTGACTGCAGGCTGCTTCTGCAGGAGGCTGCCTTCCAATGCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0865 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0865	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..552, 555..3554
Length: 1183 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5DU14	0	99.8	Myosin-XVI; Unc...	Mus musculus
EDM08808	0	94.2	myosin heavy ch...	Rattus norvegicus
Q9ERC1	0	94.2	Myosin-XVI; Unc...	Rattus norvegicus
NP_001074866	0	96.3	myosin XVI [Mus...	Mus musculus
EDL22047	4.1e-144	99.6	mCG142184 [Mus ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129372	3.8e-07	31.6	mKIAA1486

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001609 1 395 PF00063 Myosin head

IPR000048 410 430 PF00612 IQ calmodulin-binding region

HMMSmart IPR001609 2 408 SM00242 Myosin head

ProfileScan IPR000048 409 438 PS50096 IQ calmodulin-binding region

IPR000694 758 996 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001609	1	395	PF00063	Myosin head
IPR000048	410	430	PF00612	IQ calmodulin-binding region
HMMSmart	IPR001609	2	408	SM00242	Myosin head
ProfileScan	IPR000048	409	438	PS50096	IQ calmodulin-binding region
IPR000694	758	996	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	29 bp
Genome contig ID	gi65515060f_9709169
PolyA signal sequence (None)	+--------+--------+----*----+---- ATGTGATCCAGCGTGGACTGTGGGCACCTGTCTGA
Flanking genome sequence (292443 - 292492)	----+--------+--------+--------+--------+----* GCTGTCTAGTGACTGCAGGCTGCTTCTGCAGGAGGCTGCCTTCCAATGCC

Gene/Protein Characteristic Table for mKIAA0865

Features of the cloned DNA sequence

Features of the protein sequence