ROUGE

Gene/Protein Characteristic Table for mKIAA0857

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129230
Description :	Rab11 interacting protein Rip11.
Clone Name :	mpf00136 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 6119 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2056 bp

Genome contig ID gi65504368r_85584689
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AGCACTTTATGAAGAATAAAAAGATCACGTACCGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGCCAGCTTGTGTGTTTGTTTTGAAATGAGCGGACAAAGGAGACCGCCTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0857 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0857	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..4063
Length: 1353 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAI56560	0	100.0	RAB11 family in...	synthetic construct
XP_001073801	0	92.0	similar to RAB1...	Rattus norvegicus
XP_540231	9.9e-163	72.7	similar to RAB1...	Canis lupus fam...
Q8R361	7.4e-138	92.0	Rab11 family-in...	Mus musculus
EDK99125	2.7e-131	91.7	RAB11 family in...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000008 56 163 PF00168 C2

HMMSmart IPR000008 55 178 SM00239 C2

ProfileScan IPR000008 41 163 PS50004 C2

NULL 278 432 PS50324 NULL

IPR000694 877 922 PS50099 Proline-rich region

NULL 1039 1090 PS50313 NULL

IPR000694 1103 1244 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	56	163	PF00168	C2
HMMSmart	IPR000008	55	178	SM00239	C2
ProfileScan	IPR000008	41	163	PS50004	C2
NULL	278	432	PS50324	NULL
IPR000694	877	922	PS50099	Proline-rich region
NULL	1039	1090	PS50313	NULL
IPR000694	1103	1244	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2056 bp
Genome contig ID	gi65504368r_85584689
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AGCACTTTATGAAGAATAAAAAGATCACGTACCGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCCAGCTTGTGTGTTTGTTTTGAAATGAGCGGACAAAGGAGACCGCCTG

Gene/Protein Characteristic Table for mKIAA0857

Features of the cloned DNA sequence

Features of the protein sequence