ROUGE |
Gene/Protein Characteristic Table for mKIAA0844 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122387 |
---|---|
zinc finger protein 365. | |
mbh01248 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3151 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1635 bp Genome contig ID gi65524842r_67840987 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
GCAGTTCCTTGGGATGACAATAAATTGAAAAGGATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AACTCATCGTTTTCAGATACTTTGAACCTGTCCTTGTGGAGGAGAGGTTT
KIAA Alignment based on: KIAA0844 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 218..1516
Length: 432 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 51 | 76 | PF00096 | Zinc finger |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |