ROUGE

Gene/Protein Characteristic Table for mKIAA0827

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122381
Description :	Nuclear factor of activated T cells 5.
Clone Name :	mbg05617 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5481 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2379 bp

Genome contig ID gi65515060f_106556326
PolyA signal sequence
(TATAAA,-12)
+----*----+----*----+----*----+----
TTCTGTATCCTATGCCTTTTATTTATAAAGACACT
Flanking genome sequence
(114900 - 114949)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAACCATGTTTGTAATTTTAATAACATTTCCCCATCTTTTAATA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0827 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0827	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..3102
Length: 1033 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAK97603	99.9	tonicity-respon...	Mus musculus
EDL11404	99.9	nuclear factor ...	Mus musculus
AAF31405	99.9	transcription f...	Mus musculus
NP_061293	99.9	nuclear factor ...	Mus musculus
AAL50821	99.2	transcription f...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129118	0.0002	27.7	mKIAA0334
AK220216	0.00047	26.7	mKIAA0192
AK173322	0.00082	20.3	mKIAA1994

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR011539 1 43 PS50254 Rel homology

NULL 161 996 PS50322 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR011539	1	43	PS50254	Rel homology
NULL	161	996	PS50322	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2379 bp
Genome contig ID	gi65515060f_106556326
PolyA signal sequence (TATAAA,-12)	+--------+--------+----*----+---- TTCTGTATCCTATGCCTTTTATTTATAAAGACACT
Flanking genome sequence (114900 - 114949)	----+--------+--------+--------+--------+----* AAAAAAAAACCATGTTTGTAATTTTAATAACATTTCCCCATCTTTTAATA

Gene/Protein Characteristic Table for mKIAA0827

Features of the cloned DNA sequence

Features of the protein sequence