ROUGE

Gene/Protein Characteristic Table for mKIAA0797

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129219
Description :	SUMO/sentrin specific protease 6. SUMO-1-specific protease.
Clone Name :	mpm03286 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3853 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 306 bp

Genome contig ID gi65519420f_80172674
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ACTTCTAAACACAAAAATAAAATATTTATAGGAGG
Flanking genome sequence
(177197 - 177246)
----+----*----+----*----+----*----+----*----+----*
AAATGATTAATTTGATATTCTTTAGTGAACTTGCATAATTCCTCAGTGTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0797 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0797	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 23..3547
Length: 1174 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL26432	100.0	SUMO/sentrin sp...	Mus musculus
EDL26431	100.0	SUMO/sentrin sp...	Mus musculus
EDL26425	100.0	SUMO/sentrin sp...	Mus musculus
EDL26428	99.9	SUMO/sentrin sp...	Mus musculus
EDL26427	99.9	SUMO/sentrin sp...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122542	1.3e-15	27.6	mKIAA1707

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003653 728 1135 PF02902 Peptidase C48

ProfileScan NULL 22 116 PS50323 NULL

IPR003653 728 1102 PS50600 Peptidase C48

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003653	728	1135	PF02902	Peptidase C48
ProfileScan	NULL	22	116	PS50323	NULL
IPR003653	728	1102	PS50600	Peptidase C48

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	306 bp
Genome contig ID	gi65519420f_80172674
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACTTCTAAACACAAAAATAAAATATTTATAGGAGG
Flanking genome sequence (177197 - 177246)	----+--------+--------+--------+--------+----* AAATGATTAATTTGATATTCTTTAGTGAACTTGCATAATTCCTCAGTGTG

Gene/Protein Characteristic Table for mKIAA0797

Features of the cloned DNA sequence

Features of the protein sequence