ROUGE |
Gene/Protein Characteristic Table for mKIAA0791 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129217 |
---|---|
Nuclear pore complex protein Nup155. | |
mpf00383 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6136 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1864 bp Genome contig ID gi65543215f_7796919 PolyA signal sequence
(AATATA,-23) +----*----+----*----+----*----+----
TGAGTACACCTGAATATATTTCTACTTTTATCTTCFlanking genome sequence
(150280 - 150329) ----+----*----+----*----+----*----+----*----+----*
TCCTGCGATTACGGATTTCTTTTTCACAATACCGTAGAATGCAATTCCGT
KIAA Alignment based on: KIAA0791 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..4272
Length: 1423 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |