ROUGE |
Gene/Protein Characteristic Table for mKIAA0777 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122369 |
---|---|
Similar to ARG/ABL-interacting protein ARGBP2A. | |
mbg09833 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5503 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2098 bp Genome contig ID gi65515060f_44603661 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
CTTGAGTAGATACCTAATAAATTTTGCTTGAAAGTFlanking genome sequence
(164798 - 164847) ----+----*----+----*----+----*----+----*----+----*
ACCTTGGCTTCTCACTGGTGTTTATGTAGACCTTGTCTTATTCCAAGGAA
KIAA Alignment based on: KIAA0777 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..3405
Length: 1134 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |