ROUGE

Gene/Protein Characteristic Table for mKIAA0777

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122369
Description :	Similar to ARG/ABL-interacting protein ARGBP2A.
Clone Name :	mbg09833 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5503 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2098 bp

Genome contig ID gi65515060f_44603661
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CTTGAGTAGATACCTAATAAATTTTGCTTGAAAGT
Flanking genome sequence
(164798 - 164847)
----+----*----+----*----+----*----+----*----+----*
ACCTTGGCTTCTCACTGGTGTTTATGTAGACCTTGTCTTATTCCAAGGAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0777 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0777	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..3405
Length: 1134 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI66027	100.0	Sorbin and SH3 ...	synthetic construct
XP_540021	89.1	similar to Arg/...	Canis lupus fam...
AAI51039	92.9	Sorbs2 protein ...	Mus musculus
Q3UTJ2	89.9	Sorbin and SH3 ...	Mus musculus
AAI72140	91.1	Sorbs2 protein ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122487	2.1e-22	34.9	mKIAA1296

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR003127 29 159 PD016158 Sorbin-like

IPR001452 902 952 PD000066 SH3

IPR001452 977 1029 PD000066 SH3

IPR001452 1078 1131 PD000066 SH3

FPrintScan IPR001452 900 910 PR00452 SH3

IPR001452 914 929 PR00452 SH3

IPR001452 1019 1031 PR00452 SH3

HMMPfam IPR003127 6 55 PF02208 Sorbin-like

IPR001452 900 954 PF00018 SH3

IPR011511 901 954 PF07653 Variant SH3

IPR001452 975 1031 PF00018 SH3

IPR011511 976 1031 PF07653 Variant SH3

IPR001452 1078 1134 PF00018 SH3

IPR011511 1079 1134 PF07653 Variant SH3

HMMSmart IPR003127 6 56 SM00459 Sorbin-like

IPR001452 900 955 SM00326 SH3

IPR001452 975 1032 SM00326 SH3

IPR001452 1078 1134 SM00326 SH3

ProfileScan IPR003127 5 66 PS50831 Sorbin-like

IPR000694 104 213 PS50099 Proline-rich region

NULL 256 338 PS50324 NULL

NULL 674 685 PS50316 NULL

IPR001452 897 956 PS50002 SH3

IPR001452 972 1033 PS50002 SH3

IPR001452 1075 1134 PS50002 SH3

ScanRegExp IPR007087 690 712 PS00028 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR003127	29	159	PD016158	Sorbin-like
IPR001452	902	952	PD000066	SH3
IPR001452	977	1029	PD000066	SH3
IPR001452	1078	1131	PD000066	SH3
FPrintScan	IPR001452	900	910	PR00452	SH3
IPR001452	914	929	PR00452	SH3
IPR001452	1019	1031	PR00452	SH3
HMMPfam	IPR003127	6	55	PF02208	Sorbin-like
IPR001452	900	954	PF00018	SH3
IPR011511	901	954	PF07653	Variant SH3
IPR001452	975	1031	PF00018	SH3
IPR011511	976	1031	PF07653	Variant SH3
IPR001452	1078	1134	PF00018	SH3
IPR011511	1079	1134	PF07653	Variant SH3
HMMSmart	IPR003127	6	56	SM00459	Sorbin-like
IPR001452	900	955	SM00326	SH3
IPR001452	975	1032	SM00326	SH3
IPR001452	1078	1134	SM00326	SH3
ProfileScan	IPR003127	5	66	PS50831	Sorbin-like
IPR000694	104	213	PS50099	Proline-rich region
NULL	256	338	PS50324	NULL
NULL	674	685	PS50316	NULL
IPR001452	897	956	PS50002	SH3
IPR001452	972	1033	PS50002	SH3
IPR001452	1075	1134	PS50002	SH3
ScanRegExp	IPR007087	690	712	PS00028	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2098 bp
Genome contig ID	gi65515060f_44603661
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CTTGAGTAGATACCTAATAAATTTTGCTTGAAAGT
Flanking genome sequence (164798 - 164847)	----+--------+--------+--------+--------+----* ACCTTGGCTTCTCACTGGTGTTTATGTAGACCTTGTCTTATTCCAAGGAA

Gene/Protein Characteristic Table for mKIAA0777

Features of the cloned DNA sequence

Features of the protein sequence